SCOPER validation benchmark (RNA#14) Lysine Riboswitch Bound to Lysine

SCOPER is an efficient tool that can accurately predict the solution state of RNAs and provide an atomistic model of their structure. To validate SCOPER pipeline, we collected experimental SAXS data on a Lysine Riboswitch Bound to Lysine.

Lysine riboswitch RNA preparation: The lysine riboswitch RNA sample was prepared from in vitro T7 polymerase transcriptions reactions using PCR-generated DNA templates. The crude RNA was purified by 10%–12% denaturing gel electrophoresis as described. RNA samples were eluted from crushed gel slices overnight at 4°C into RNA storage buffer as described above. Chromatographic separations were performed with the Ettan LC liquid chromatography system (GE Healthcare) configured with a 3-wavelength ultraviolet-visual (UV-VIS) detector. Purifications were performed with Superose 6 column (GE Healthcare) in running buffer containing 20 mM MOPS at pH 6.5, 50 mM KCl, and 7.6 mM MgCl2. Flowthrough from the respective buffer was kept for buffer subtraction during SAXS analysis. Small-angle X-ray scattering: SAXS experiments were performed at beamline 12.3.1 of the Advanced Light Source, Lawrence Berkeley National Laboratory. Twenty microliters of purified RNA samples and corresponding matching buffers were loaded into a 96-well plate (Nunc) and covered with a protective film. RNA samples were collected at 2–3 mg/mL and diluted serial in the plate. Automated loading of the SAXS samples into the sample cuvette was achieved using a Hamilton syringe robot as described. For each sample, several exposures were taken using the following time sequence of 5, 50, and 5 sec or 6, 60, and 6 sec. All data collection was performed at room temperature. The first and last exposures of each sequence were compared to assess for radiation damage. Integration, scaling, and buffer subtraction was accomplished using the program Ogre (Greg Hura, Lawrence Berkeley National Laboratory). The scattering angle, q, was calculated as 4 π sin(θ/2)/λ where θ/2 is the scattering angle measured from the Bragg plane and λ is the wavelength in Å. A fixed detector distance was maintained at 1.486 m and with a wavelength of 1.03 Å (12,000 eV), and data were collected over the q range of 0.0088–0.322 Å−1.

LYS_riboswitch.dat..zip: LYS riboswitch SAXS final curve; best_3d0u_with_mg.dat : SCOPER SAXS fit; 3d0u_original.pdb : LYS riboswitch crystal structure; best_3d0u_with_mg.pdb : SCOPER model

2023-03-03

2023-03-04

HT-SAXS

1.03 Å

1.486 m

Sample:

• Macromolecule 1: LYS- riboswitch
• Sample Full Name: Lysine Riboswitch Bound To Lysine
• Sample Type: RNA
• Source Organism: Homo Sapiens
• Source Organism NCBI Taxonomy ID: 9606
• Expression System:
• Expression NCBI Taxonomy ID:
• Uniprot ID:
• Sequence or Chemical Formula:
• GGACGGAGGCGCGCCCGAGAUGAGUAGGCUGUCCCAUCAGGGGAGGAAUCGGGGACGGCUGAAAGGCGAGGGCGCCGAAGCGAGCAGAGUUCCUCCCGCUCUGCUUGGCUGGGGGUGAGGGGAAUACCCUUACCACUGUCGCGAAAGCGGAGAGCCGUCCA