SCOPER validation benchmark (RNA#13) P4P6 (300mM KCl and 5mM Mg++)

SCOPER is an efficient tool that can accurately predict the solution state of RNAs and provide an atomistic model of their structure. To validate SCOPER pipeline, we collect experimental SAXS data from a monomeric RNA state, free of contaminants (higher oligomeric state obtain and aggregation). We applied Size Exclusion Chromatography coupled with small angle X-ray scattering (SEC-SAXS).

Data were collected at SIBYLS beamline 12.3.1 at Advanced Light Source with recently reported developed SEC-SAXS-MALS modality (Rosenberg et al. 2022 Methods Enzymol). X-ray wavelength was set at λ=1.127 Å, and the sample to detector distance was 2100 mm, resulting in scattering vectors, q, ranging from 0.01 Å-1 to 0.4 Å-1. A total of 60-95 μL of annealed RNAs with a concentration between 1 and 3 mg/ml were prepared in the SEC running buffer (20mM Tris pH 7.4, 300mM KCl, 5mM MgCl2). The Shodex KW802.5 column was equilibrated with running buffer with a flow rate of 0.65 mL/min. Each sample was injected in an SEC column, and two second X-ray exposures were recorded continuously for 24 min.

p4p6_300mM_5mM.zip: 660 SEC-SAXS frames; best_p4p6_with_mg.dat : SCOPER SAXS fit; original_p4p6.pdb : P4P6 crystal structure; best_p4p6_with_mg.pdb : SCOPER model

2023-03-04

2023-03-04

SEC-SAXS

1.127 Å

2.1 m

Sample:

• Macromolecule 1: P4P6
• Sample Full Name: P4P6 RNA
• Sample Type: RNA
• Source Organism: Homo Sapiens
• Source Organism NCBI Taxonomy ID: 9606
• Expression System:
• Expression NCBI Taxonomy ID:
• Uniprot ID's:
• Sequence or Chemical Formula:
• GAAUUGGGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCCCCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUC