Back

Open Dataset XSSMOQZI


SCOPER validation benchmark (RNA#2) RocR stem-loop

Abstract

SCOPER is an efficient tool that can accurately predict the solution state of RNAs and provide an atomistic model of their structure. To validate SCOPER pipeline, we collect experimental SAXS data from a monomeric RNA state, free of contaminants (higher oligomeric state obtain and aggregation). We applied Size Exclusion Chromatography coupled with small angle X-ray scattering (SEC-SAXS).

Experimental description

Data were collected at SIBYLS beamline 12.3.1 at Advanced Light Source with recently reported developed SEC-SAXS-MALS modality (Rosenberg et al. 2022 Methods Enzymol). X-ray wavelength was set at λ=1.127 Å, and the sample to detector distance was 2100 mm, resulting in scattering vectors, q, ranging from 0.01 Å-1 to 0.4 Å-1. A total of 60-95 μL of annealed RNAs with a concentration between 1 and 3 mg/ml were prepared in the SEC running buffer (10mM HEPES pH 7.5 100mM KCl, 5mM MgCl2, 1mM TCEP). The Shodex KW802.5 column was equilibrated with running buffer with a flow rate of 0.65 mL/min. Each sample was injected in an SEC column, and two second X-ray exposures were recorded continuously for 24 min.

File description

jk11_2.zip: 600 SEC-SAXS frames, best_jk11_with_mg.dat : SCOPER SAXS fit, jk11_original_deepfoldRNA_output.pdb : DeepfoldRNA prediction best_jk11_with_mg.pdb : SCOPER model

Created

2023-03-02

Published

2023-03-04

Data collection technique

SEC-SAXS

Journal DOI

Source

Beamline

Wavelength

1.127 Å

Sample to Detector Distance

2.1 m


Submitting Author

M. Hammel

Lawrence Berkeley National Laboratory, The SIBYLS Beamline

United States of America

Collaborators

Project Leader

M. Hammel


Data Download Terms:

The data available for download is free to use, however by clicking a download link, it signifies that you agree to our Terms of Service and Privacy Policy.


Complete Set of SAS Data Files

The complete SAS dataset is downloadable as a zip file.


Individual SAS Data Files (Total: 1)

These are individual SAS data files that may be raw or processed (merged, etc.). These may or not be included in a zip file containing a larger dataset.


Supplemental Data and Supporting Materials (Total: 2)

These data and materials may include X-ray crystal structure coordinates, multi-angle light scattering data, .etc. It may also include additional details or methods pertaining to the SAXS experiments, or the researcher's interpretations of the results.


Open SAXS data analysis sites in a new tab using these links

SAXS Similarity SAXS FrameSlice


Sample:

  • Macromolecule 1: RocR
    • Sample Full Name: trans-acting sRNA, RocR
    • Sample Type: RNA
    • Source Organism: Homo Sapiens
    • Source Organism NCBI Taxonomy ID: 9606
    • Expression System:
    • Expression NCBI Taxonomy ID:
    • Uniprot ID's:
    • Sequence or Chemical Formula:
    • UGGGUCAAUUGGCGACACACUGAUUGGCCCUUUCU