Open Dataset XSEF1RT7
SCOPER validation benchmark (RNA#1) RocR stem-loop
SCOPER is an efficient tool that can accurately predict the solution state of RNAs and provide an atomistic model of their structure. To validate SCOPER pipeline, we collect experimental SAXS data from a monomeric RNA state, free of contaminants (higher oligomeric state obtain and aggregation). We applied Size Exclusion Chromatography coupled with small angle X-ray scattering (SEC-SAXS).
Experimental descriptionData were collected at SIBYLS beamline 12.3.1 at Advanced Light Source with recently reported developed SEC-SAXS-MALS modality (Rosenberg et al. 2022 Methods Enzymol). X-ray wavelength was set at λ=1.127 Å, and the sample to detector distance was 2100 mm, resulting in scattering vectors, q, ranging from 0.01 Å-1 to 0.4 Å-1. A total of 60-95 μL of annealed RNAs with a concentration between 1 and 3 mg/ml were prepared in the SEC running buffer (10mM HEPES-KOH pH 7.5, 100mM KCl, 5mM MgCl2, 1mM TCEP). A Shodex KW802.5 column was equilibrated with running buffer with a flow rate of 0.65 mL/min. Each sample was injected in an SEC column, and two second X-ray exposures were recorded continuously for 24 min.
File descriptionjin1zip: 600SEC-SAXS frames best_jin1_with_mg.dat : SCOPER SAXS fit jin1_original_deepfoldRNA_output.pdb : DeepfoldRNA prediction best_jin1_with_mg.pdb : SCOPER model
2023-03-02
Updated2023-03-04
Data collection techniqueSEC-SAXS
Journal DOI
Beamline
Wavelength
1.127 Å
Sample to Detector Distance2.1 m
Michal Hammel
Lawrence Berkeley National Laboratory, The SIBYLS Beamline
United States of America
Collaborators
Project LeaderMichal Hammel
Data Download Terms:
The data available for download is free to use, however by clicking a download link, it signifies that you agree to our Terms of Service and Privacy Policy.
Complete Set of SAS Data Files
The complete SAS dataset is downloadable as a zip file.
- jin1.zip Download
Individual SAS Data Files (total 1)
These are individual SAS data files that may be raw or processed (merged, etc.). These may or not be included in a zip file containing a larger dataset.
- best_jin1_with_mg.dat Download
Supplemental Data and Supporting Materials (total 2)
These data and materials may include X-ray crystal structure coordinates, multi-angle light scattering data, .etc. It may also include additional details or methods pertaining to the SAXS experiments, or the researcher's interpretations of the results.
Open SAXS data analysis sites in a new tab using these links
SAXS Similarity SAXS FrameSliceSample:
- Macromolecule 1: RocR
- Sample Full Name: trans-acting sRNA, RocR
- Sample Type: RNA
- Source Organism: Homo Sapiens
- Source Organism NCBI Taxonomy ID: 9606
- Expression System:
- Expression NCBI Taxonomy ID:
- Uniprot ID:
- Sequence or Chemical Formula:
- UGGGUCAAUCUUCGGAUUGGCCCUUUCU